View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10133_low_9 (Length: 377)
Name: NF10133_low_9
Description: NF10133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10133_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 4 - 361
Target Start/End: Complemental strand, 33386462 - 33386105
Alignment:
| Q |
4 |
caaaggctctaacatcatcctttattgcattaatccctaagaagaataatccacaatccttatcggaataccaccctatctctctaattcttagtggaga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33386462 |
caaaggctctaacatcatcctttattgcattaatccctaagaagaataatccacagtccttatcggaataccaccctatctctctaattcttagtggaga |
33386363 |
T |
|
| Q |
104 |
tggaggtttcttcttgacacaaatatcatatggcatccttttttgcattgcagatatggaagtcttagcgaggttgtcattataggtgatggtgaaagta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33386362 |
tggaggtttcttcttgacacaaatatcatatggcatccttttttgcattgcagatatggaagtcttagcgaggttgtcattataggtgatggtgaaagta |
33386263 |
T |
|
| Q |
204 |
ttgacaacaagtatcctttattgtggagagatataatatctatgggatcattagccaataataactcaaactggtttgtgggcggtgtaaaattaaggtc |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33386262 |
ttgacaacaagtatcctttatggtggagagatataatatctatgggatcattagccaataataactcaaaccggtttgtgggcggtgtaaaattaaggtc |
33386163 |
T |
|
| Q |
304 |
gggaggtggtgacaatatcaagttatggagagaaaaatggttgtgcacagaacctctt |
361 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33386162 |
gggaggtggcgacaatatcaagttatggagagaaaaatggttgtgcacagaacctctt |
33386105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University