View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10134_high_5 (Length: 282)

Name: NF10134_high_5
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10134_high_5
NF10134_high_5
[»] chr3 (4 HSPs)
chr3 (1-245)||(29070133-29070377)
chr3 (142-246)||(6587918-6588025)
chr3 (143-194)||(11413444-11413495)
chr3 (143-192)||(3837033-3837081)
[»] chr1 (2 HSPs)
chr1 (143-194)||(35820113-35820164)
chr1 (144-190)||(33096029-33096075)
[»] chr8 (4 HSPs)
chr8 (143-192)||(18896788-18896837)
chr8 (152-194)||(4830385-4830427)
chr8 (147-193)||(18896628-18896674)
chr8 (143-188)||(11873515-11873560)
[»] chr4 (3 HSPs)
chr4 (143-196)||(4701702-4701755)
chr4 (212-246)||(4460243-4460277)
chr4 (144-189)||(29248016-29248061)
[»] chr7 (2 HSPs)
chr7 (145-193)||(41415842-41415890)
chr7 (143-194)||(41415642-41415693)
[»] scaffold0007 (1 HSPs)
scaffold0007 (143-194)||(201480-201531)
[»] scaffold0267 (1 HSPs)
scaffold0267 (143-189)||(12539-12584)
[»] chr5 (1 HSPs)
chr5 (143-189)||(5003497-5003543)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 29070377 - 29070133
Alignment:
1 tctcttatgcactttatcctgctccaagcacaaataaacattacatacaaacaaaaaccatcaagaatgaaaatgaccaagagtttccatgtccaatccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
29070377 tctcttatgcactttatcctgctccaagcacaaataaacattacatacaaacaaaaaccatcaagaatgaaaatgaccacgagtttccatgtccaatccg 29070278  T
101 a-ttttttcattcatcttccctttcagcaaacaagtatttaaacttaattgcagttttggccttctaagtattacaatcttgcaattttggccccatnnn 199  Q
    | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||       
29070277 atttttttcattcattttccctttcagcaaacaagtatttaaacttaattgcagttttggcctcctaagtattacaatcttgcaattttggccccataaa 29070178  T
200 nnnncaataacaagtccccttagtttacccccttttgcacttttgg 245  Q
        ||||||||||| || | |||||||||||||||||||||||||    
29070177 aaaacaataacaagt-ccttaagtttacccccttttgcacttttgg 29070133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 142 - 246
Target Start/End: Original strand, 6587918 - 6588025
Alignment:
142 acttaattgcagttttggccttctaagtattacaatcttgcaattttggccccatnnnnnnncaataacaagt---ccccttagtttacccccttttgca 238  Q
    |||||||||||||||| ||| ||||||||| |||||||||||||||| ||||| |       ||||||||| |   ||| | ||||||||||||||||||    
6587918 acttaattgcagtttttgccctctaagtatcacaatcttgcaattttcgccccctataaaaacaataacaaatcagcccataagtttacccccttttgca 6588017  T
239 cttttggc 246  Q
    ||||||||    
6588018 cttttggc 6588025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 194
Target Start/End: Complemental strand, 11413495 - 11413444
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcccc 194  Q
    ||||||||||||||| ||| ||||||| ||||||||||||||||||||||||    
11413495 cttaattgcagttttagccctctaagttttacaatcttgcaattttggcccc 11413444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 192
Target Start/End: Original strand, 3837033 - 3837081
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcc 192  Q
    |||||||||| |||||||||| ||||||| ||||||||||||||||||||    
3837033 cttaattgcatttttggcctt-taagtatcacaatcttgcaattttggcc 3837081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 143 - 194
Target Start/End: Complemental strand, 35820164 - 35820113
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcccc 194  Q
    |||||||||||||||||||  |||||||| |||||||||| |||||||||||    
35820164 cttaattgcagttttggccccctaagtatcacaatcttgcgattttggcccc 35820113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 190
Target Start/End: Original strand, 33096029 - 33096075
Alignment:
144 ttaattgcagttttggccttctaagtattacaatcttgcaattttgg 190  Q
    |||||||||||||||||| ||||| |||  |||||||||||||||||    
33096029 ttaattgcagttttggccctctaaatatcgcaatcttgcaattttgg 33096075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 192
Target Start/End: Complemental strand, 18896837 - 18896788
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcc 192  Q
    |||||||||||||||||||| |||||||| |||||||||  |||||||||    
18896837 cttaattgcagttttggcctcctaagtatcacaatcttgtgattttggcc 18896788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 194
Target Start/End: Complemental strand, 4830427 - 4830385
Alignment:
152 agttttggccttctaagtattacaatcttgcaattttggcccc 194  Q
    |||||||||| ||||||||| |||||||||| |||||||||||    
4830427 agttttggccctctaagtatcacaatcttgcgattttggcccc 4830385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 193
Target Start/End: Complemental strand, 18896674 - 18896628
Alignment:
147 attgcagttttggccttctaagtattacaatcttgcaattttggccc 193  Q
    |||||||||||||||  |||||||| |||||||||| ||||||||||    
18896674 attgcagttttggccccctaagtatcacaatcttgcgattttggccc 18896628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 143 - 188
Target Start/End: Original strand, 11873515 - 11873560
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaatttt 188  Q
    |||||||||||||||||||| |||| ||| |||||||||| |||||    
11873515 cttaattgcagttttggcctcctaaatatcacaatcttgcgatttt 11873560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 4701702 - 4701755
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggccccat 196  Q
    ||||||||||||||||  ||||||||||| |||||||| | |||||||||||||    
4701702 cttaattgcagttttgatcttctaagtatcacaatcttacgattttggccccat 4701755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 212 - 246
Target Start/End: Original strand, 4460243 - 4460277
Alignment:
212 agtccccttagtttacccccttttgcacttttggc 246  Q
    |||||||| ||||||||||||||||||||||||||    
4460243 agtcccctaagtttacccccttttgcacttttggc 4460277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 189
Target Start/End: Original strand, 29248016 - 29248061
Alignment:
144 ttaattgcagttttggccttctaagtattacaatcttgcaattttg 189  Q
    |||||||||||||||||| ||||||||| ||||||||  |||||||    
29248016 ttaattgcagttttggccctctaagtatcacaatcttctaattttg 29248061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 145 - 193
Target Start/End: Complemental strand, 41415890 - 41415842
Alignment:
145 taattgcagttttggccttctaagtattacaatcttgcaattttggccc 193  Q
    ||||||||||||||||||  ||||||| |||||||||| ||||||||||    
41415890 taattgcagttttggcctcttaagtatcacaatcttgcgattttggccc 41415842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 194
Target Start/End: Original strand, 41415642 - 41415693
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcccc 194  Q
    ||||||||||||||||| |  |||||||| |||||||||| |||||||||||    
41415642 cttaattgcagttttggtcacctaagtatcacaatcttgcgattttggcccc 41415693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 194
Target Start/End: Original strand, 201480 - 201531
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttggcccc 194  Q
    |||||||||||||||||||  |||||| | |||||||||| |||||||||||    
201480 cttaattgcagttttggccccctaagtttcacaatcttgccattttggcccc 201531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0267 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0267
Description:

Target: scaffold0267; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 189
Target Start/End: Original strand, 12539 - 12584
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttg 189  Q
    |||||||||| |||||||||| ||||||| |||||||||||||||||    
12539 cttaattgcatttttggcctt-taagtatcacaatcttgcaattttg 12584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 189
Target Start/End: Original strand, 5003497 - 5003543
Alignment:
143 cttaattgcagttttggccttctaagtattacaatcttgcaattttg 189  Q
    ||||||||||||||||| | ||||||||| |||||||||| ||||||    
5003497 cttaattgcagttttggtcctctaagtatcacaatcttgcgattttg 5003543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University