View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_12 (Length: 258)
Name: NF10134_low_12
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10134_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 41781594 - 41781827
Alignment:
| Q |
1 |
ttggaggatgaaaccgattgttattaaaattggaatgatcaatgtaacaaaattttgtacaacataaaatgctggnnnnnnntgtgcctaattgtctaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
41781594 |
ttggaggatgaaaccgattgttattaaaattggaatgatcaatgtaacaaaattttgtacaacataaaatgctggaaaaaaatgtgccgaattgtctaat |
41781693 |
T |
 |
| Q |
101 |
tcagattaagattacatttcataaattcatagcatcataacaactagtaccatttgattggaatttattgtttgtacatatatcctctagattcgattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41781694 |
tcagattaagattacatttcataaattcatagcatcataacaactagtaccatttgattggaatttattgtttgtacatatatcctctagattcgattgt |
41781793 |
T |
 |
| Q |
201 |
gatgtttttgaaactggaattttatgttgccttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41781794 |
gatgtttttgaaactggaattttatgttgccttt |
41781827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University