View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_14 (Length: 250)
Name: NF10134_low_14
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10134_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 52651316 - 52651509
Alignment:
| Q |
1 |
cttttcaccgtgatttaaagaagctgcaaaaacaagcttatcctccaacgtggtttttccatagctgaagtgaaaaatccaccgccaaagcaaacatgca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
52651316 |
cttttcaccgtgatttaaagaaggtgcaaaaacaagcttctcctccaacgtggtttttccatagctgaagtgaaaaatccacggtcaaagcaaacatgca |
52651415 |
T |
 |
| Q |
101 |
tgctattagtcattttaatggaaagaaagaatatagtggtcattttcacaaatagtggcataatggtaattacc--atggggctgaagtagtgg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52651416 |
tgctattagtcattttaatggaaagaaaggatatagtggtcattttcacaaatagtggcataatggtaattaccatatggggctgaagtagtgg |
52651509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 34661616 - 34661662
Alignment:
| Q |
2 |
ttttcaccgtgatttaaagaagctgcaaaaacaagcttatcctccaa |
48 |
Q |
| |
|
|||||||||||||||||||||||| | ||| ||||||| |||||||| |
|
|
| T |
34661616 |
ttttcaccgtgatttaaagaagctaccaaagcaagcttctcctccaa |
34661662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 3876713 - 3876633
Alignment:
| Q |
2 |
ttttcaccgtgatttaaagaagctgcaaaaacaagcttatcctccaacgtggtttttccatagctgaagtgaaaaatccacc |
83 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| ||||||||||| | ||||||| || |||||||||||| |||| |
|
|
| T |
3876713 |
ttttcaccgtgatttaaagaagttgcaaaagcaagcttctcctccaacgt-gattttccaccgccgaagtgaaaaattcacc |
3876633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University