View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_16 (Length: 239)
Name: NF10134_low_16
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10134_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5799850 - 5800073
Alignment:
| Q |
1 |
tgaggaatgcgcacataagtannnnnnnctctcattcttttaacgaaataagatgaaaagaaatgaaatagcgtacatgccttcttgagcaaggtaacag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799850 |
tgaggaatgcgcacataagtatttttttctctcattcttttaacgaaataagatgaaaagaaatgaaatagcgtacatgccttcttgagcaaggtaacag |
5799949 |
T |
|
| Q |
101 |
cggtagtcccactgccataagattccatgaaatattgcaatttgagttcgttgtccataaacttagacgctttcaaaaatgattctctcaatatctcgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799950 |
cggtagtcccactgccataagattccatgaaatattgcaatttgagttcgttgtccataaacttagacgctttcaaaaatgattctctcaatatctcgaa |
5800049 |
T |
|
| Q |
201 |
atggttattattataattattatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5800050 |
atggttattattataattattatt |
5800073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University