View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_17 (Length: 239)
Name: NF10134_low_17
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10134_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 41781552 - 41781463
Alignment:
Q |
1 |
gcatttgtgatttctccaaatgtgggaatggaatacaataattacctgaaaatggagcttcatatgtaccgaatcgatttgattaaacct |
90 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41781552 |
gcatttgtgatttctccaaatgtgtgaatggaatacaataattacctgaaaatggagcttcatatgtaccgaatcgatttgattaaacct |
41781463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 41781388 - 41781330
Alignment:
Q |
165 |
tattgttgtcgtgcctgtcccattctcttttgagagcaacatgtaatcttggcacttct |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41781388 |
tattgttgtcgtgcctgtcccattctcttttgagagcaacatgtaatcttggcacttct |
41781330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University