View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10134_low_17 (Length: 239)

Name: NF10134_low_17
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10134_low_17
NF10134_low_17
[»] chr8 (2 HSPs)
chr8 (1-90)||(41781463-41781552)
chr8 (165-223)||(41781330-41781388)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 41781552 - 41781463
Alignment:
1 gcatttgtgatttctccaaatgtgggaatggaatacaataattacctgaaaatggagcttcatatgtaccgaatcgatttgattaaacct 90  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41781552 gcatttgtgatttctccaaatgtgtgaatggaatacaataattacctgaaaatggagcttcatatgtaccgaatcgatttgattaaacct 41781463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 41781388 - 41781330
Alignment:
165 tattgttgtcgtgcctgtcccattctcttttgagagcaacatgtaatcttggcacttct 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41781388 tattgttgtcgtgcctgtcccattctcttttgagagcaacatgtaatcttggcacttct 41781330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University