View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_18 (Length: 238)
Name: NF10134_low_18
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10134_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 38766410 - 38766346
Alignment:
Q |
20 |
ccaactttaaacgtaaatctataaacatgttgaacattattttgactcaaatacattatcaatac |
84 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
38766410 |
ccaacgttaaacgtaaatctataaacatgctgaacattattttgactcaaatacattatcaatac |
38766346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 226
Target Start/End: Complemental strand, 38766255 - 38766222
Alignment:
Q |
193 |
gtgccgtctatctaatgtgacatgacattaatga |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
38766255 |
gtgccgtctatctaatgtgacatgacattaatga |
38766222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University