View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10134_low_6 (Length: 354)
Name: NF10134_low_6
Description: NF10134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10134_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 32163459 - 32163793
Alignment:
| Q |
1 |
tcttgcaagtttgctctctgcttgtgctcaattggaaaatattgttatgggaaagttacttcatgttctggtagttaagtatggattggatgatacttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163459 |
tcttgcaagtttgctctctgcttgtgctcaattggaaaatattgttatgggaaagttacttcatgttctggtagttaagtatggattggatgatacttca |
32163558 |
T |
|
| Q |
101 |
ttgaggaattctcttgttgatatgtatgcgaagtgtggacttattcctgatgcacattatgtgtttgcaactacggtggataaggatgttgtttcttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163559 |
ttgaggaattctcttgttgatatgtatgcgaagtgtggacttattcctgatgcacattatgtgtttgcaactacggtggataaggatgttgtttcttgga |
32163658 |
T |
|
| Q |
201 |
attcggttatttcgggttatgcacagagtggatcagcatatgaagcccttgagctcttcaacaggatgagaatggaatcgtttttgccagatgcggttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163659 |
attcggttatttcgggttatgcacagagtggatcagcatatgaagcccttgatctcttcaacaggatgagaatggaatcgtttttgccagatgcggttac |
32163758 |
T |
|
| Q |
301 |
ggttgttggtgttctctcagcttgtgcttctgttg |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163759 |
ggttgttggtgttctctcagcttgtgcttctgttg |
32163793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University