View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_high_10 (Length: 259)
Name: NF10135_high_10
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10135_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 31583467 - 31583223
Alignment:
Q |
1 |
ctccttttggtcaatacataaaccagttccttttagttcattgatctctcagaatggcttccatgtataatatcaaccctatcctccattttcttcaatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
31583467 |
ctccttttggtcaatacataaaccagttccttttagttcattgatctctcagcatggcttccatgtataatatcaaccctatcctccattttcttcagtt |
31583368 |
T |
 |
Q |
101 |
cataatcctcttgaaactgattcagatacctttatatttaagcacaaatgagggttgtgagaatctgtttaattgtggaactataaaaccaattggtttt |
200 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
T |
31583367 |
cataatccttttgaaactgattcagatacctttatgtttgagcacaaatgaaggttgtgagaatctgtttaattgtggaaatataaaacaaattggtttt |
31583268 |
T |
 |
Q |
201 |
cctttctggggagggaatcgaccaaaagagtgtggccaccctttg |
245 |
Q |
|
|
||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
31583267 |
cctttctggggagaggatcgaccaaaagagtgtggccaccctttg |
31583223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 80 - 245
Target Start/End: Complemental strand, 31641994 - 31641829
Alignment:
Q |
80 |
tatcctccattttcttcaattcataatcctcttgaaactgattcagatacctttatatttaagcacaaatgagggttgtgagaatctgtttaattgtgga |
179 |
Q |
|
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
31641994 |
tatcctccattttcttcagttcataatccttttgaaactgattcagatacctttatgtttgagcacaaatgaaggttgtgagaatctgtttaattgtgga |
31641895 |
T |
 |
Q |
180 |
actataaaaccaattggttttcctttctggggagggaatcgaccaaaagagtgtggccaccctttg |
245 |
Q |
|
|
| |||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
31641894 |
aatataaaacaaattggttttcctttctggggagaggatcgaccaaaagagtgtggccaccctttg |
31641829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University