View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_high_7 (Length: 300)
Name: NF10135_high_7
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10135_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 155 - 295
Target Start/End: Original strand, 33454383 - 33454523
Alignment:
| Q |
155 |
gagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgcttttgatcttcgttggttgcca |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33454383 |
gagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgattttgatcttcgttggttgcca |
33454482 |
T |
 |
| Q |
255 |
ttgttaaattcttggaatgttttgcttctttctctgcttct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33454483 |
ttgttaaattcttggaatgttttgcttctttttctgtttct |
33454523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33454217 - 33454302
Alignment:
| Q |
1 |
tgggtgttttgctgtgacctct--caactctttcatggcttcatgttctcttgggaagacactggtgtctagaatatactgtacat |
84 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33454217 |
tgggtgttttgctgtgacctctctcaactctttcatggcttcatgttctcttgggaagacactggtctctagaatatactgtacat |
33454302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University