View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_13 (Length: 274)
Name: NF10135_low_13
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10135_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 166 - 272
Target Start/End: Original strand, 27670291 - 27670397
Alignment:
| Q |
166 |
tttgttcatcttttgcataaggtggattggaagctgaaggtggttgcttcattgtggtcggagtagttgcagaagcttcgccggaaaactcgtctgggtt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27670291 |
tttgttcatcttttgcataaggtggattggaagctgaaggtggttgcttcattgtggtcggagtagttgcagaagcttcgccggaaaactcgtctgagtt |
27670390 |
T |
 |
| Q |
266 |
gggtgtt |
272 |
Q |
| |
|
||||||| |
|
|
| T |
27670391 |
gggtgtt |
27670397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 17 - 108
Target Start/End: Original strand, 27670127 - 27670218
Alignment:
| Q |
17 |
catagcagattcattctccttcaccaatgtagcagccaaagatattttgtttcacctgaacatgtttcagagaaaaatctagaattggcaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27670127 |
catagcagattcattctccttcaccaatgtagcagccaaagatattttgtttcacctgaacatgtttcagagaaaaatctagaattggcaac |
27670218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University