View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_15 (Length: 255)
Name: NF10135_low_15
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10135_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 66 - 223
Target Start/End: Complemental strand, 35818105 - 35817948
Alignment:
| Q |
66 |
ccctaactaaccttttcgtttttgaagcgagtacgaatattgccgagttctttatcaacacgaagacgctcttgttctttgttctggcaattgcggatgt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35818105 |
ccctaactaaccttttcgtttttgaagcgagtacgaatattgccgagttctttatcaacacgaagacgctcttgttctttgttctggcaattgcggatgt |
35818006 |
T |
 |
| Q |
166 |
cgcttataaacacggaaagtcctctcatacccgacatcgccatcgccgatgccgaatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35818005 |
cgcttataaacacggaaagtcctctcatacccgacatcgccatcgccgatgccgaatc |
35817948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University