View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_16 (Length: 238)
Name: NF10135_low_16
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10135_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 37195299 - 37195097
Alignment:
Q |
1 |
ttaaagatattgaaaagaaacgttgtgtacctgtctgaagagagacattccgcgtcgaattgcgagaagggcttcattggtgttgttattgccgctgccg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37195299 |
ttaaagatattgaaaagaaacgttgtgtacctgtctgaagagagacattccgcgtcgaattgcgagaagggcttcattggtgttgttattgccgctgccg |
37195200 |
T |
 |
Q |
101 |
ccggtgttggcgtcccagatacccgaaacagaaggaaggaagagtcttcgagagagatttgaaggattggagcaaaagatgggtggtttaaaagatgatg |
200 |
Q |
|
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37195199 |
ccggtgatggcgtcccagataccggaaacagaaggaaggaagagtcttcgagagagatttgaaggattggagcaaaagatgggtggtttaaaagatgatg |
37195100 |
T |
 |
Q |
201 |
atg |
203 |
Q |
|
|
||| |
|
|
T |
37195099 |
atg |
37195097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University