View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10135_low_17 (Length: 237)

Name: NF10135_low_17
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10135_low_17
NF10135_low_17
[»] chr4 (2 HSPs)
chr4 (9-148)||(47802897-47803036)
chr4 (141-222)||(47803610-47803691)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 9 - 148
Target Start/End: Original strand, 47802897 - 47803036
Alignment:
9 agagatgaagtcaatttctcataccattttgctagcttatttaaggccataaaatggtttcaataacttgattagatttatagcatgacactccctcaag 108  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47802897 agagatgaagtcaatttctcataccattttgctagcttattcaaggccataaaatggtttcaataacttgattagatttatagcatgacactccctcaag 47802996  T
109 aatcaccagaaatacattattttcatcaagttgatgtaag 148  Q
    |||||||||||| |||||||||||||||| ||||||||||    
47802997 aatcaccagaaacacattattttcatcaaattgatgtaag 47803036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 141 - 222
Target Start/End: Original strand, 47803610 - 47803691
Alignment:
141 gatgtaagtacgagttattgatagcaagtaaatctagaaccattaacgagaattttggaatcatcacttgaaaataattgtg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
47803610 gatgtaagtacgagttattgatagcaagtaaatctagaaccattaacgagaattttggaatcatcacttgaaaatgattgtg 47803691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University