View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_17 (Length: 237)
Name: NF10135_low_17
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10135_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 9 - 148
Target Start/End: Original strand, 47802897 - 47803036
Alignment:
| Q |
9 |
agagatgaagtcaatttctcataccattttgctagcttatttaaggccataaaatggtttcaataacttgattagatttatagcatgacactccctcaag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802897 |
agagatgaagtcaatttctcataccattttgctagcttattcaaggccataaaatggtttcaataacttgattagatttatagcatgacactccctcaag |
47802996 |
T |
 |
| Q |
109 |
aatcaccagaaatacattattttcatcaagttgatgtaag |
148 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
47802997 |
aatcaccagaaacacattattttcatcaaattgatgtaag |
47803036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 141 - 222
Target Start/End: Original strand, 47803610 - 47803691
Alignment:
| Q |
141 |
gatgtaagtacgagttattgatagcaagtaaatctagaaccattaacgagaattttggaatcatcacttgaaaataattgtg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47803610 |
gatgtaagtacgagttattgatagcaagtaaatctagaaccattaacgagaattttggaatcatcacttgaaaatgattgtg |
47803691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University