View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_19 (Length: 226)
Name: NF10135_low_19
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10135_low_19 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 27671010 - 27670785
Alignment:
Q |
1 |
agtaatattggatgaagctcatgaaagtcactttcatgtggtatggtgtctccaaattgtacgaggatattaaaaaagactattggtgtccatagagata |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
27671010 |
agtaatattggatgaagctcatgaaagtcactttcatgtggtatggtatctccaaattgtacgaggatattaaaaaagactattggtgtccatagagaca |
27670911 |
T |
 |
Q |
101 |
taacataatcaaattttannnnnnnngagggagcataatcaacttgttttaaagaataaaataagtaatatcactcatgagtaaaataaattaatattta |
200 |
Q |
|
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
27670910 |
taacataatcaactttttttttttttgagggagcataatcaacttgttttaaagaataaaataagtaatatcattcatgagtaaaataaattaatattta |
27670811 |
T |
 |
Q |
201 |
atattacttgcaaatgcataataaat |
226 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
27670810 |
atattacttgcaaatgcataataaat |
27670785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University