View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10135_low_19 (Length: 226)

Name: NF10135_low_19
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10135_low_19
NF10135_low_19
[»] chr7 (1 HSPs)
chr7 (1-226)||(27670785-27671010)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 27671010 - 27670785
Alignment:
1 agtaatattggatgaagctcatgaaagtcactttcatgtggtatggtgtctccaaattgtacgaggatattaaaaaagactattggtgtccatagagata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |    
27671010 agtaatattggatgaagctcatgaaagtcactttcatgtggtatggtatctccaaattgtacgaggatattaaaaaagactattggtgtccatagagaca 27670911  T
101 taacataatcaaattttannnnnnnngagggagcataatcaacttgttttaaagaataaaataagtaatatcactcatgagtaaaataaattaatattta 200  Q
    |||||||||||| ||||         ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
27670910 taacataatcaactttttttttttttgagggagcataatcaacttgttttaaagaataaaataagtaatatcattcatgagtaaaataaattaatattta 27670811  T
201 atattacttgcaaatgcataataaat 226  Q
    ||||||||||||||||||||||||||    
27670810 atattacttgcaaatgcataataaat 27670785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University