View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10135_low_5 (Length: 338)
Name: NF10135_low_5
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10135_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 23 - 328
Target Start/End: Complemental strand, 9311474 - 9311154
Alignment:
Q |
23 |
ttcacatcttttggcaaatttgtcatgctaagcttctcactaatgtgagagaactcacttt-tatgattattgttgtcgaattagagatttagttcagac |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||| ||| |
|
|
T |
9311474 |
ttcacatcttttggcaaatttgtcatgctaagcttctcactaatgtgagagaacttactttgtatgaatattgttgtcgaattagagatttagttgagat |
9311375 |
T |
 |
Q |
122 |
atcggttgatagtttttaattgtatttttctttattctagcaattgttttgtggaaggaaatgtatctccaagttatatgtttcttaactgcttcaatag |
221 |
Q |
|
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
9311374 |
atcggttgatagtttttaattgtgtttttctttagtctagcaattgttttgcggaaggaaatgtatctccaagttatatgtttcttaactgcttcagtag |
9311275 |
T |
 |
Q |
222 |
agcgttaagtacgagtttttggaatgaaattacgtaa---ataacttgggtttgatagcttgtgtgcctttaaaggtt-----------gtatttatagg |
307 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
9311274 |
agcgttaagtacgagtttttggaatgaaattacgtaaataataacttgggtttgatagcttgtgtgcctttaaaggttgtagaagatgagtatttatagg |
9311175 |
T |
 |
Q |
308 |
aaaaactattcatgatgtcca |
328 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
9311174 |
aaaaactattcatgatgtcca |
9311154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University