View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10135_low_9 (Length: 300)

Name: NF10135_low_9
Description: NF10135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10135_low_9
NF10135_low_9
[»] chr4 (2 HSPs)
chr4 (155-295)||(33454383-33454523)
chr4 (1-84)||(33454217-33454302)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 155 - 295
Target Start/End: Original strand, 33454383 - 33454523
Alignment:
155 gagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgcttttgatcttcgttggttgcca 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
33454383 gagtgtacctggtaaagagcatcactttgtagaagactcttgtgaccaacttcttggtgtcttccagattcagtttgattttgatcttcgttggttgcca 33454482  T
255 ttgttaaattcttggaatgttttgcttctttctctgcttct 295  Q
    ||||||||||||||||||||||||||||||| |||| ||||    
33454483 ttgttaaattcttggaatgttttgcttctttttctgtttct 33454523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33454217 - 33454302
Alignment:
1 tgggtgttttgctgtgacctct--caactctttcatggcttcatgttctcttgggaagacactggtgtctagaatatactgtacat 84  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
33454217 tgggtgttttgctgtgacctctctcaactctttcatggcttcatgttctcttgggaagacactggtctctagaatatactgtacat 33454302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University