View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10136_low_11 (Length: 248)
Name: NF10136_low_11
Description: NF10136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10136_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 4751378 - 4751608
Alignment:
| Q |
1 |
ttttctctcttgaagcaaacaggagaaaacttcaatttcctcccagtttctcttgtatcaaacaatgtgttagtgaataaaataaacatgcaagtcttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4751378 |
ttttctctcttgaagcaaacaggagaaaacttcaatttcctcccagtttctcttgtatcaaacaatgtgttagtgaataaaataaacatgcaagtcttaa |
4751477 |
T |
|
| Q |
101 |
ttgtgctatggattctaggcagcactaagcatcaaatggatccagaaagaaataagtatcactgtggtttgttctaacataatgtcttaaatttttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4751478 |
ttgtgctatggattctaggcagcactaagcatcaaatggatccagaaagaaataagtatcaccgtggtttgttctaacgtaatgtcttaaatttttatca |
4751577 |
T |
|
| Q |
201 |
tttccaagtaccacaaagcaccgcatttgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4751578 |
tttccaagtaccacaaagcaccgcatttgat |
4751608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University