View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10136_low_14 (Length: 234)
Name: NF10136_low_14
Description: NF10136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10136_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 46 - 211
Target Start/End: Complemental strand, 39037122 - 39036957
Alignment:
| Q |
46 |
tacctcatggttactcacttcaccatccccattcagcaatgcgacagtagagacctttgagatgaggttgttgttgtgttactttaggaaatatcaatca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39037122 |
tacctcatggttactcacttcaccatccccattcagcaatgcgacagtagagacctttgagatgaggttgttgttgtgttactttaggaaatatcaatca |
39037023 |
T |
|
| Q |
146 |
atcatacaacttttgaggtaaatacacatacacgtgccaaatagcattatcattccatgattaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39037022 |
atcatacaacttttgaggtaaatacacatacacgtgccaaatagcattatcattccatgattaatt |
39036957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University