View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10136_low_15 (Length: 228)
Name: NF10136_low_15
Description: NF10136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10136_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 48159343 - 48159229
Alignment:
| Q |
17 |
caattagttgccatactggtttctattttaatgattgttccatcagctgatgctgttgatgcactcaaaacttgtgcttgtttgctcaaggaatgcaggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159343 |
caattagttgccatactggtttctattttaatgattgttccatcagctgatgctgttgatgcactcaaaacttgtgcttgtttgctcaaggaatgcaggt |
48159244 |
T |
 |
| Q |
117 |
atgctactataccac |
131 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
48159243 |
atgctgctataccac |
48159229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 142 - 214
Target Start/End: Complemental strand, 48159204 - 48159132
Alignment:
| Q |
142 |
ttgccaaatgttagtagcagagattcaactctaaaccacctacatataactctttaggtgtccccgcctatgc |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48159204 |
ttgccaaatgttagtagcagatattcaactctaaaccacctacatataactctttaggtgtccctgcctatgc |
48159132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University