View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10136_low_5 (Length: 371)
Name: NF10136_low_5
Description: NF10136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10136_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 360
Target Start/End: Original strand, 2555995 - 2556338
Alignment:
| Q |
18 |
agaccattctcaccggtgatgaatccatagttgccgcttccatggttgtccttaacatcgtcgtaatggaagaaaccaccgaaataaatctccagcttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2555995 |
agaccattctcaccggtgatgaatccatagttgccgcttccatggttgtccttaacatcgtcgtaatggaagaaaccaccgaaataaatctccagcttca |
2556094 |
T |
|
| Q |
118 |
tgtttcactttctcaattggatagcaccacaatactacaaatggcaaaaatctgaaaaagtttcatttttcaggaggagatcaaacaa-cccctcaacct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2556095 |
tgtttcactttctcaattggatagcaccacaatactacaaatgacaaaaatctgaaaaagtttcatttttcaggaggagatcaaacaaccccctcaacct |
2556194 |
T |
|
| Q |
217 |
cattatcattgttttcatcgtagtaggtgtattttgcaagcatgtcgatgatttcggagctcgaatgtgagttgaaggactcgatttaagcatcgttgaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556195 |
cattatcattgttttcatcgtagtaggtgtattttggaagcatgtcgatgatttcggagctcgaatgtgagttgaaggactcgatttaagcatcgttgaa |
2556294 |
T |
|
| Q |
317 |
tcgttttcggcactgaatgagttcttaaaattggttaggtctct |
360 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556295 |
tcgtttccggcactgaatgagttcttaaaattggttaggtctct |
2556338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University