View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_high_9 (Length: 211)
Name: NF10137_high_9
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10137_high_9 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 211
Target Start/End: Complemental strand, 53693835 - 53693631
Alignment:
Q |
7 |
gtacatggcattctgttagattggagttggtttgagcttcatcatcttgtttgctcaaagaatcatcagtatcataatacagttttggttcctgaccaac |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53693835 |
gtacatggcattctgttagattggagttggtttgagcttcatcatcttgtttgctcaaagaatcatcagtatcataatacagttttggttcctgaccaac |
53693736 |
T |
 |
Q |
107 |
ctatatattttgtcattgttatcatggttttccatgttttgaaatttctaatctgtatggattattccttcacaggtcagaggagactcgaaacagaaat |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53693735 |
ctatatattttgtcattgttatcatggttttccatgttttgaaatttctaatctgtatggattattccttcacaggtcagaggagactcgaaacagaaat |
53693636 |
T |
 |
Q |
207 |
gcagt |
211 |
Q |
|
|
||||| |
|
|
T |
53693635 |
gcagt |
53693631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University