View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_11 (Length: 328)
Name: NF10137_low_11
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 28737136 - 28736922
Alignment:
| Q |
12 |
tatatgataaaatactttcgaaccaacaacgggttttgtaaaaagtctatcaagtaaatataaatatacaagggtaattctatgaaacattattcaagtg |
111 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28737136 |
tatatgataaaatacttttgatccaacaacgtgttttgtaaaaaatctatcaagtaaatataaatatacaagggtaattctatgaaacattattcaagtg |
28737037 |
T |
 |
| Q |
112 |
ttacagcaatataattatatccctctttatatcaaagatttggatacaactgactttttgttatattttttctctcccatgtctaatgagagattataag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28737036 |
ttacagcaatataattatatccctctttacatcaaagatttggatacaactgactttttgttatattttttctctcccatgtctaatgagagattataag |
28736937 |
T |
 |
| Q |
212 |
taatgtatttttata |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28736936 |
taatgtatttttata |
28736922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 28736898 - 28736866
Alignment:
| Q |
281 |
attgaccaaattttatagtggatactccatgat |
313 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
28736898 |
attgaccgaattttatagtggatactccatgat |
28736866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University