View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_14 (Length: 262)
Name: NF10137_low_14
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 75 - 245
Target Start/End: Complemental strand, 16084482 - 16084310
Alignment:
| Q |
75 |
acactagtaatgattgaaaaacatgaaagatgattgaaccagtgtcaaacaccaacatgtgttagacacctaacacatcttcaatctaaagtacctatgc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16084482 |
acactagtaatgattgaaaaacatgaaagatgattgaaccgatgtcagacaccaacatgtgttagacacctaacacatcttcaatctaaagtacctatgc |
16084383 |
T |
 |
| Q |
175 |
--catgggttgacgtatcaagttggaacttacattgaaaactctcaatgaaatttgtatttatgtagttcttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16084382 |
cacatgggttgacgtatcaagttggaacttacattgaaaactctcaatgaaatttgtatttatgtagttcttt |
16084310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 42 - 138
Target Start/End: Complemental strand, 16084579 - 16084483
Alignment:
| Q |
42 |
gacatgggacacgacactgacacttacgcttagacactagtaatgattgaaaaacatgaaagatgattgaaccagtgtcaaacaccaacatgtgtta |
138 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
16084579 |
gacatgggacccgacactgacacttacgcttagacactagtaatgattgaaaaacatgaaagatgattgaaccgatgtcagacaccaacatgtgtta |
16084483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University