View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_15 (Length: 250)
Name: NF10137_low_15
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 42076610 - 42076384
Alignment:
| Q |
17 |
cataatatacacgcgtatacacaatacttccttgcactcactccacaatccaccatatataacgtgtcaccttcttgttttgcatggcactttgtcttta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42076610 |
cataatatacacgcgtatacacaatacttccttgcgctcactccacaatccaccatatataacgtgtcaccttcttgttttgcatggcactttgtcttta |
42076511 |
T |
|
| Q |
117 |
a---caaccaagtcaattctttaacaagcttctcgtaccttcccctgtttttatgaccctctgctttcgnnnnnnnggttatggcggttcatagcaaaaa |
213 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42076510 |
acaacaaccaagtcaattctttaacaagcttctcgtaccttcccctgtttttatgaccctctgctttcgtttttttggttatggcggttcatagcaaaaa |
42076411 |
T |
|
| Q |
214 |
catgttttccattgttctatctctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
42076410 |
catgttttccattgttctatctttgtg |
42076384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University