View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_16 (Length: 248)
Name: NF10137_low_16
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10137_low_16 |
 |  |
|
[»] scaffold0114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0114 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 5773 - 5986
Alignment:
Q |
17 |
gacatcacaggtaagcaacataataaatcattctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaa |
116 |
Q |
|
|
||||||| |||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5773 |
gacatcataggtaaacgacataataaatcagtctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaa |
5872 |
T |
 |
Q |
117 |
cgctaaaaatagactgaaaatatgacacaacatggtcctctatctcaattgggtccgagatgacattatccccatcatgaagaatggacatatgtttaga |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
5873 |
cgctaaaaatagactgaaaatatgacacaacatgctcctctatctcaattgggtccgagatgacattatccctatcatgaagaatggacatatgtttaga |
5972 |
T |
 |
Q |
217 |
gaccgcacgtacct |
230 |
Q |
|
|
||||||||||||| |
|
|
T |
5973 |
aaccgcacgtacct |
5986 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University