View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_18 (Length: 244)
Name: NF10137_low_18
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 44714696 - 44714470
Alignment:
| Q |
1 |
atttggacatggattaacatacacacattttgttcacgaattatctagtgcacccacggtggtgtcagttccggtccatggtcaccgacatggcaacaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44714696 |
atttggacatggattaacatacacacattttgttcacgaattatctagtgcacccacagtggtgtcagttccagtccatggtcaccgacatggcaacaac |
44714597 |
T |
|
| Q |
101 |
acaaacatttcaaacaaagcaattagagtgacacatgcaagatgtggcaaactctcaattgcccttcacgttgatgtaaaaaatgtgggatctagagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714596 |
acaaacatttcaaacaaagcaattagagtgacacatgcaagatgtggcaaactctcaattgcccttcacgttgatgtaaaaaatgtgggatctagagatg |
44714497 |
T |
|
| Q |
201 |
gcactcacaccttgttagtgttctctg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44714496 |
gcactcacaccttgttagtgttctctg |
44714470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 225
Target Start/End: Original strand, 39091189 - 39091296
Alignment:
| Q |
118 |
agcaattagagtgacacatgcaagatgtggcaaactctcaattgcccttcacgttgatgtaaaaaatgtgggatctagagatggcactcacaccttgtta |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||| ||| || ||||||| ||||| || || || | |||||| ||| |||| ||||| |
|
|
| T |
39091189 |
agcaattagagtgacacatgcacgatgtggcaagctttcaattagacttgacattgatgttaaaaacgttggttcaaaagatggtactaacactttgttg |
39091288 |
T |
|
| Q |
218 |
gtgttctc |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
39091289 |
gtgttctc |
39091296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University