View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_19 (Length: 243)
Name: NF10137_low_19
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 32498494 - 32498703
Alignment:
| Q |
18 |
aggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtcatttacccgatttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32498494 |
aggaagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacaaccatgatgacctcttcatttacccgatttg |
32498593 |
T |
 |
| Q |
118 |
caaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgat------ttagcaatctactttgtcttctcacacctctga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
32498594 |
caaccatgataatcttattacttacctgattgcataaccatgacgagttgcagaaaatgatcctgacttagcaatctactttgtcttctcacacctatga |
32498693 |
T |
 |
| Q |
212 |
tgtgcagtgt |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
32498694 |
tgtgcagtgt |
32498703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 127
Target Start/End: Complemental strand, 37185353 - 37185246
Alignment:
| Q |
21 |
aagtccattacctcatcactatccggtcaccaaccatgatattcacatcacttatccggtggcacagccatgatgacctcgtcatttacccgatt-tgca |
119 |
Q |
| |
|
||||| |||| | ||||| |||| ||||||||| ||||||| ||||||||||| || |||||| ||||||| ||||||||| |||| ||||| | || |
|
|
| T |
37185353 |
aagtctattatcccatcattatctggtcaccaatcatgatactcacatcacttgcccaccggcacaaccatgataacctcgtcacttactcgattgtcca |
37185254 |
T |
 |
| Q |
120 |
accatgat |
127 |
Q |
| |
|
|||||||| |
|
|
| T |
37185253 |
accatgat |
37185246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University