View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10137_low_9 (Length: 351)
Name: NF10137_low_9
Description: NF10137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10137_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 44714745 - 44715085
Alignment:
| Q |
1 |
cctattttgcttggtctcattgccatatttgtcatggccaagttttttaggtactcttgtgggtaccatgtcactggtagcttgcctcctgatagtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714745 |
cctattttgcttggtctcattgccatatttgtcatggccaagttttttaggtactcttgtgggtaccatgtcactggtagcttgcctcctgatagtaaaa |
44714844 |
T |
 |
| Q |
101 |
cacaatagtgtaataattgtattagtttataggctatttgcaattgggaattcattcaattttttcaagttttatgacaaacctgggctagcagttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714845 |
cacaatagtgtaataattgtattagtttataggctatttgcaattgggaattcattcaattttttcaagttttatgacaaacctgggctagcagttccaa |
44714944 |
T |
 |
| Q |
201 |
ataaaatgtcagcaattgcagcaccaccagcttggcctggataacccgcccacaatatgccagcaactttggggtcattctttgcaaaagtaatgtccac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44714945 |
ataaaatgtcagcaattgcagcaccaccagcttggcctggataacccgcccacaatatgccagcaactttggggtcattctttgcaaaagtaatgtccac |
44715044 |
T |
 |
| Q |
301 |
aggcccaccagacatcaaaaccaaaatagttggtccctttg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715045 |
aggcccaccagacatcaaaaccaaaatagttggtccctttg |
44715085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 92
Target Start/End: Complemental strand, 39091018 - 39090935
Alignment:
| Q |
9 |
gcttggtctcattgccatatttgtcatggccaagttttttaggtactcttgtgggtaccatgtcactggtagcttgcctcctga |
92 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||| |||||||| ||||||| |
|
|
| T |
39091018 |
gcttggtctcattgccatatttgtcattgccaagtttttgaggtaaccttgtgggtaccatgtcataggtagcttagctcctga |
39090935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 333
Target Start/End: Complemental strand, 39090498 - 39090342
Alignment:
| Q |
177 |
acaaacctgggctagcagttccaaataaaatgtcagcaattgcagcaccaccagcttggcctggataacccgcccacaatatgccagcaactttggggtc |
276 |
Q |
| |
|
||||||||||| ||| |||||||| || || || ||||| ||||||||||| ||||| || |||||||| |||||||| ||||| || | || || |
|
|
| T |
39090498 |
acaaacctgggttagtggttccaaacaatatatccgcaatggcagcaccaccggcttgaccaggataaccagcccacaaaatgcccataattcgaggatc |
39090399 |
T |
 |
| Q |
277 |
attctttgcaaaagtaatgtccacaggcccaccagacatcaaaaccaaaatagttgg |
333 |
Q |
| |
|
||||||||||||||| || || | ||||||||||||||| || |||||||| ||||| |
|
|
| T |
39090398 |
attctttgcaaaagttatatctataggcccaccagacattaagaccaaaatggttgg |
39090342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University