View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10138_high_4 (Length: 301)
Name: NF10138_high_4
Description: NF10138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10138_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 21 - 290
Target Start/End: Original strand, 28612434 - 28612700
Alignment:
| Q |
21 |
caggattcttcttaaagaaaggttttaggcagtatgtttccataatctgttcattatggatagctcgatacaagatgatgtttccatgatccgttcatcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612434 |
caggattcttcttaaagaaaggttttaggcagtatgtttccataatctgttcattatggatagctcgatacaagatgatgtttccatgatccgttcatcg |
28612533 |
T |
 |
| Q |
121 |
aaaattttatatatgtctgctacacattctacaagtgtaatgccaattttttatgataatgtttatattggtcaatcaagtgagtttcactttgattttg |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28612534 |
aaaattttatatatgactgctacacattctacaagtgtaatgccaatttttgatgataatgtttatattggtcaatcaagtgagtttcactttgattttg |
28612633 |
T |
 |
| Q |
221 |
ttgaaagatcatagtttgattatactctagtcttttctaggttatcttatagggtgtgtatgtctctgct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
28612634 |
ttgaaagatcatagtttgattatactctagtcttttctaggctatc---tagggtgtgtatgtttctgct |
28612700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University