View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10138_high_5 (Length: 295)
Name: NF10138_high_5
Description: NF10138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10138_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 25 - 278
Target Start/End: Complemental strand, 46618540 - 46618287
Alignment:
| Q |
25 |
aagaaacaagaaacctgttactcttaatttttagtctaactagctagaatttatacaaattgtctaggcttttatttaattttccacatgtttcttatgt |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618540 |
aagaaacaagaaacctgttagtcttaatttttagtctaactagctagaatttatacaaattgtctaggcttttatttaattttccacatgtttcttatgt |
46618441 |
T |
 |
| Q |
125 |
acactcacatgcatagtaaggaatttaacttcnnnnnnnnctctctaaagtgaaggatatcaaggaagattcacatgatttaattgtgttttgatttaat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618440 |
acactcacatgcatagtaaggaatttaaccttttttttctctctctaaagtgaaggatatcaaggaagattcacatgatttaattgtgttttgatttaat |
46618341 |
T |
 |
| Q |
225 |
attgtttctataaccatttatgatgagttatgaggtcattctgcatacaacaat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618340 |
attgtttctataaccatttatgatgagttatgaggtcattctgcatacaacaat |
46618287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University