View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10138_high_8 (Length: 234)
Name: NF10138_high_8
Description: NF10138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10138_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 8445469 - 8445674
Alignment:
Q |
18 |
gttttgagaattaaaaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatgaatgtttatcnnn |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
8445469 |
gttttgagaattaaaaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatggatgtttatcttt |
8445568 |
T |
 |
Q |
118 |
nnnncaataaaactaaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgggcaatacattgattttc |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8445569 |
ttttcaataaaactaaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgggcaatacattgattttc |
8445668 |
T |
 |
Q |
218 |
atctct |
223 |
Q |
|
|
|||||| |
|
|
T |
8445669 |
atctct |
8445674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University