View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10138_high_8 (Length: 234)

Name: NF10138_high_8
Description: NF10138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10138_high_8
NF10138_high_8
[»] chr5 (1 HSPs)
chr5 (18-223)||(8445469-8445674)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 8445469 - 8445674
Alignment:
18 gttttgagaattaaaaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatgaatgtttatcnnn 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||       
8445469 gttttgagaattaaaaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatggatgtttatcttt 8445568  T
118 nnnncaataaaactaaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgggcaatacattgattttc 217  Q
        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8445569 ttttcaataaaactaaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgggcaatacattgattttc 8445668  T
218 atctct 223  Q
    ||||||    
8445669 atctct 8445674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University