View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10138_low_9 (Length: 276)
Name: NF10138_low_9
Description: NF10138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10138_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 50 - 252
Target Start/End: Original strand, 42004279 - 42004492
Alignment:
| Q |
50 |
tctaaagatatcactttgtaggtaaatcat----------gattttgtttttatgagaatgatattttgacaactattttagaataacataatcttaaac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42004279 |
tctaaagatatcactttgtaggtaaatcatacatattattgattttgtttttatgagaatgatattttgacaactattttagaataacataatcttaaac |
42004378 |
T |
|
| Q |
140 |
tccttatgcaatgtcatttagtatttcttttaataa-nnnnnnngtctatcttagttttagtgtcaatacctatattgtcttgtttcatataaatctgga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42004379 |
tccttatgcaatgtcatttagtatttcttttaataattttttttgtctatcttagttttagtgtcaatacctatattgtcttgtttcatattaatctgga |
42004478 |
T |
|
| Q |
239 |
tcctcttatcccct |
252 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42004479 |
tcctcttatcccct |
42004492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University