View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10139_low_13 (Length: 211)
Name: NF10139_low_13
Description: NF10139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10139_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 177
Target Start/End: Complemental strand, 43163604 - 43163444
Alignment:
| Q |
17 |
aggtacttccaagttacgatacttaaacccacacgaatacaagtcagcatagaatgtttcaaatgtacctcatcaaaatgcagcagtgaaaacaaaatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
43163604 |
aggtacttccaagttacgatacttaaacccacacgaatacaagtcagcatacaatgtttcaaatatacctcatcaaaatgcaccagttaaaacaaaatat |
43163505 |
T |
 |
| Q |
117 |
ggaacctttctgttttgttataaagaaagaacccaagattaccaaatctaatcatgtggat |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163504 |
ggaacctttctgttttgttataaagaaagaacccaagattaccaaatctaatcatgtggat |
43163444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 111 - 170
Target Start/End: Complemental strand, 51464452 - 51464397
Alignment:
| Q |
111 |
aaatatggaacctttctgttttgttataaagaaagaacccaagattaccaaatctaatca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
51464452 |
aaatatggaacctttctgttttgttataa----agaacccaagattaccaaacctaatca |
51464397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University