View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10139_low_9 (Length: 241)
Name: NF10139_low_9
Description: NF10139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10139_low_9 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 379469 - 379691
Alignment:
Q |
19 |
aagacgccctttgatgtcttgatgtagaagctccaaccattgagaagcaacagtagcagctgnnnnnnnngaagtatttgtatgagtaaaggctcaagaa |
118 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| || |
|
|
T |
379469 |
aagacgccctttgatgtcttgatgtaaaagctccaaccattgagaagcaacagtagcagctgaaaaaaaagaagtatttgtataagtaaaggctcaaaaa |
379568 |
T |
 |
Q |
119 |
gcatccatcagcaaaggctcaataagcttcaatatcggctaaagaaattttttattttagatcccagttcttatacatatttgattttacaagctgaaac |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
379569 |
gcatccatcagcaaaggctcaataagcttcaatatcggctaaagaaattttttattttagatcccagttcttatacatatttgattttacaagctgaaac |
379668 |
T |
 |
Q |
219 |
atggataccctagacaacttttt |
241 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
379669 |
atggataccctagacaacttttt |
379691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University