View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_high_12 (Length: 241)
Name: NF10140A_high_12
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 42292553 - 42292778
Alignment:
| Q |
15 |
tatatatgtgaaaaaattgatagagtaaggaacaagttgattgtttattcttaatttgattgaagtctactggcacacaaatttacaaggatacggtgga |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292553 |
tatatatgtgaaaaaattgatagtttaaggaacaagttgattgtttattcttaatttgattgaagtctactggcacacaaatttacaaggatacggtgga |
42292652 |
T |
 |
| Q |
115 |
tatagggaagttatacctgatatccctacatttaatctttttaccccctacaaattgttgaaaatgccaaatttaccttttatcatttcacttcaccctg |
214 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292653 |
tatggggaagttatacctgatatccctacatttaatc-ttttaccccctacaaattgttgaaaatgccaaatttaccttttatcatttcacttcaccctg |
42292751 |
T |
 |
| Q |
215 |
cataaaattttagccagcaatacactt |
241 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
42292752 |
cataaaattttagccaacaatacactt |
42292778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University