View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_116 (Length: 323)
Name: NF10140A_low_116
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_116 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 24860684 - 24860836
Alignment:
| Q |
1 |
tcagaggcgagagggcttaagcacaggcttagggttattaatgtaatttacttgaaattttgaagatttagcgtttcgttttctaatgtaatcg--tatc |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24860684 |
tcagaggcgagagggcttaagcataggcttagggttattaatgtaatttacttgaaatttcgaagatttagcgtttcgttttctaatgtaatcgtatatc |
24860783 |
T |
|
| Q |
99 |
ggtgatgtaatgtttattattatcggaatgaaatgaaatgaaattactggtttc |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24860784 |
ggtgatgtaatg-ttattattatcggaatgaaatgaaatgaaattactggtttc |
24860836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 243 - 308
Target Start/End: Original strand, 24860928 - 24860995
Alignment:
| Q |
243 |
ggtgatattgggctgggcttaagtgtggcccac--aactttattggggcccatttaattggcgggaat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24860928 |
ggtgatattgggctgggcttaagtgtggcccacaaaactttattggggcccatttaattggcgggaat |
24860995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University