View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_133 (Length: 306)
Name: NF10140A_low_133
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_133 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 233
Target Start/End: Original strand, 29041571 - 29041798
Alignment:
| Q |
10 |
ggttctggctcttataagatatgagttggattattaccaattaaaccaaatatttgttggtatttattatttcttttatttatcagaagttttgacttgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29041571 |
ggttctggctcttataagatatgagttggattattaccaattaaaccaaatatttgttggtatttattatttcttttatttatcagaagttttgacttgg |
29041670 |
T |
|
| Q |
110 |
tcatttttgggtagatttctagacttgacttgatcttcttttctcatttatgatcttacc--tatcttatcactatg--gtatatgctattccggtgcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
29041671 |
tcatttttgggtagatttctagacttgacttgatcttcttttctcatttatgatcttacctatatcttaccactatgatatatatgctattcaggtgcaa |
29041770 |
T |
|
| Q |
206 |
gtttattttgaggtacaattcttatata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29041771 |
gtttattttgaggtacaattcttatata |
29041798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University