View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_142 (Length: 300)
Name: NF10140A_low_142
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_142 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 29 - 282
Target Start/End: Original strand, 41922972 - 41923225
Alignment:
| Q |
29 |
gagagagatgtctcatttcagagagaacaagttgaagaatgacagggatggagacggggaggattaagagtagagattacaatggatattcacgggaagc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922972 |
gagagagatgtctcatttcagagagaacaagttgaaaaatgacagggatggagacggggagaattaagagtagagattacaatggatattcacgggaagc |
41923071 |
T |
 |
| Q |
129 |
aaagtattcatcggctactcacttatgaaataaaattgatattattgtcaacttcgtattagtctttgttgatgtccgttaggtgggtattttacaaatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41923072 |
aaagtattcatcggctactcacttatgaaataaaattgatattattgtcaacttcgtattagtccttgttgatgtccgttagatgggtattttacaaatt |
41923171 |
T |
 |
| Q |
229 |
ttgaatcatcatcacagacgtacgtccatcaaactctaaaataggtggttcttg |
282 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923172 |
ttgaatcatcatcacaaacgtacgtccatcaaactctaaaataggtggttcttg |
41923225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University