View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_15 (Length: 443)
Name: NF10140A_low_15
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 432; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 432; E-Value: 0
Query Start/End: Original strand, 12 - 443
Target Start/End: Complemental strand, 43408523 - 43408092
Alignment:
| Q |
12 |
gagataacaaactcaataacaccaaggcatgtcccacttcctctctcaaaaactggaagtgctagaagagatccatattgctgttgctgctgatgacgcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408523 |
gagataacaaactcaataacaccaaggcatgtcccacttcctctctcaaaaactggaagtgctagaagagatccatattgctgttgctgctgatgacgcg |
43408424 |
T |
 |
| Q |
112 |
gatagtcatggcttctaaagaaacgaacatgaacgttcatgtttggattcacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408423 |
gatagtcatggcttctaaagaaacgaacatgaacgttcatgtttggattcacagaaacaggtgcagatgatgactcctgctgaaggtagtggttttgagt |
43408324 |
T |
 |
| Q |
212 |
gtgaattagggctgatctcctcctcataggtacccatatctgaataaggacgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaacc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408323 |
gtgaattagggctgatctcctcctcataggtacccatatctgaataaggacgttgttggatgagttctttgtgtactcttttaagtaaccaacagcaacc |
43408224 |
T |
 |
| Q |
312 |
actaatctttctttgacagatgttgttggacctggatttgccctaggcccaatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcat |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408223 |
actaatctttctttgacagatgttgttggacctggatttgccctaggcccaatccaccatctcttcccaacaacaaaaccactttcctgctgatcatcat |
43408124 |
T |
 |
| Q |
412 |
gatttgctgctggagcagtgcattccatttga |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43408123 |
gatttgctgctggagcagtgcattccatttga |
43408092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University