View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_156 (Length: 293)
Name: NF10140A_low_156
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_156 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 281
Target Start/End: Original strand, 5665062 - 5665342
Alignment:
| Q |
3 |
agcaaactgagggaggcaggagggattccgaatgaaccagaggagcagtctcaaccacaagagcaaccaacagctgaatatccactactccaccctct-- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665062 |
agcaaactgagggaggcaggagggattccgaatgaaccagaagagcagtctcaaccacaagagcaaccaacagctgaatatccactactccaccctctct |
5665161 |
T |
|
| Q |
101 |
gatcgttaattacatgtttggagcggtaaattggatgcaagaagcatcatctcagttgtacattgagccaccacatttctctcagcagttcgctgaagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5665162 |
gatcgttaattacatgtttggagcggcaaattggatgcaagaagcatcatctcagttgtacattgagccaccacatttctctcagcagtttgctgaagca |
5665261 |
T |
|
| Q |
201 |
gcattgcagtctttcagaataggcagaagcctagagggtcttttgagaggtttggtacaaaggagaggacaaggggatatt |
281 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
5665262 |
gcgttgcagtcttgcagaataggcagaagcctagagggtcttttgagaggtttggtacaaagaagagggtaaggggttatt |
5665342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University