View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_16 (Length: 443)
Name: NF10140A_low_16
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 423; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 423; E-Value: 0
Query Start/End: Original strand, 7 - 441
Target Start/End: Complemental strand, 41498004 - 41497570
Alignment:
| Q |
7 |
ataccatggtcagaaagaaaagcaaaattggtttcaccattgaagtttatttaggaactcattttacttgggcttgaaataactgtcatcaattgaaagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41498004 |
ataccatggtcagaaagaaaagcaaaattggtttcactattgaagtttatttaggaactcattttacttgggcttgaaataactgtcatcaattgaaagt |
41497905 |
T |
|
| Q |
107 |
tggtcaaatgcatcaaaattcgctttcaaaccaacaaactggctacctagttgagcacaaccaccatttggccacctgcagcctccatctttagtacgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497904 |
tggtcaaatgcatcaaaattcgctttcaaaccaacaaactggctacctagttgagcacaaccaccatttggccacctgcagcctccatctttagtacgaa |
41497805 |
T |
|
| Q |
207 |
acgggcatagagagtcacatattcgaccaataacatcgtttccatcatcaccgtcatcttctgttacagacacatatagatcctttttgtcgttaatcac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497804 |
acgggcatagagagtcacatattcgaccaataacatcgtttccatcatcaccgtcatcttctgttacagacacatatagatcctttttgtcgttaatcac |
41497705 |
T |
|
| Q |
307 |
agcactacttgatccttgcctagaggaacaatacaagtttggatgtgctcccgctgggttgctttcgatgtcaacaatgcaatcaccactactagaaatg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41497704 |
agcactacttgatccttgcctagaggaacaatacaagtttggatgtgctcccgctgggttgttttcaatgtcaacaatgcaatcaccactactagaaatg |
41497605 |
T |
|
| Q |
407 |
tgaatcttgcacccaattgactgaattgcacgctt |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497604 |
tgaatcttgcacccaattgactgaattgcacgctt |
41497570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University