View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_165 (Length: 287)
Name: NF10140A_low_165
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_165 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 6 - 281
Target Start/End: Original strand, 5035460 - 5035735
Alignment:
| Q |
6 |
tttggtgttcagcataatcagaaattgtggaagatggctttaatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035460 |
tttggtgttcagcataatcagaaattgtggaagatggctttaatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgta |
5035559 |
T |
 |
| Q |
106 |
atttaataacttttatagcagtgtttgtgaaataaaaaacttacaaagcacatatattaaagannnnnnnnaaggatatctattaaagaattaaaaaatt |
205 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5035560 |
atttaataacttttataacagagtttgtgaaataaaaaacttacaaagcacatatattaaagattttttttaaggatatctattaaagaattaaaaaatt |
5035659 |
T |
 |
| Q |
206 |
cacttcacaaggattcaactcaaatatcacaataatctttacttgagttatgttgttggtggaaagacctcgtttg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035660 |
cacttcacaaggattcaactcaaatatcacaataatctttacttgagttatgttgttggtggaaagacctcgtttg |
5035735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University