View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_173 (Length: 285)
Name: NF10140A_low_173
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_173 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 32 - 285
Target Start/End: Complemental strand, 6917921 - 6917668
Alignment:
| Q |
32 |
caaattaccattacttcaagtttttaacctttaccattgatcttggaaacgaccatgtaaccttgttgttctcatgacataagccatttgacttttcaac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917921 |
caaattaccattacttcaagtttttaacctttaccgttgatcttggaaatgaccatgtaaccttgttgttctcatgacataagccatttgacttttcaac |
6917822 |
T |
|
| Q |
132 |
accagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacagcatgcatgtgtgccaagaacagtcatcaaatagtg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6917821 |
accagtggacaaattatgttaacatcatagcctctcaaccaaccataacacaggcgtggaaacatcatgcatatgtgccaagaacagtcatcaaatagtg |
6917722 |
T |
|
| Q |
232 |
caaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917721 |
caaaaattacttatcacttggccctgcaccatctcttagtggaaactgagtgtt |
6917668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University