View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_174 (Length: 283)
Name: NF10140A_low_174
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_174 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 23 - 277
Target Start/End: Complemental strand, 41705158 - 41704904
Alignment:
Q |
23 |
gtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaa |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41705158 |
gtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaa |
41705059 |
T |
 |
Q |
123 |
cataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttg |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41705058 |
cataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttg |
41704959 |
T |
 |
Q |
223 |
gaaaattcaggtcatgttgacacaaatcgagcacttgagtgtgcaagtggtcttc |
277 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41704958 |
gaaaattcaggtcaagttgacacaaatcgagcacttgagtgtgcaagtggtcttc |
41704904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 25 - 107
Target Start/End: Complemental strand, 1453347 - 1453265
Alignment:
Q |
25 |
atggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
107 |
Q |
|
|
|||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
T |
1453347 |
atggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1453265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 25 - 107
Target Start/End: Complemental strand, 1465039 - 1464957
Alignment:
Q |
25 |
atggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
107 |
Q |
|
|
|||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
T |
1465039 |
atggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1464957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 80
Target Start/End: Complemental strand, 7564146 - 7564110
Alignment:
Q |
44 |
cttggttacccggttcatgtgtcacacaagacatgcc |
80 |
Q |
|
|
|||||||||| ||||||||||| |||||||||||||| |
|
|
T |
7564146 |
cttggttacctggttcatgtgttacacaagacatgcc |
7564110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University