View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_176 (Length: 283)
Name: NF10140A_low_176
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_176 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 100 - 283
Target Start/End: Complemental strand, 4271167 - 4270984
Alignment:
| Q |
100 |
agtttgaattatggctaaaataattatttatcagactctatttacgttccggccaaatattgatttatcataatcccttctttaaaaatcggaaggttaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||| | |||||||||||||||||||| | |||| |
|
|
| T |
4271167 |
agtttgaattatggctaaaataattatttgtcagactctatttacgtcccgaccaaatattgatttatcagagtcccttctttaaaaatcggaggattaa |
4271068 |
T |
 |
| Q |
200 |
gataaaaaagacaggaaacaacaaatgttctttttaatttgtttatatttcattcttgagcatatttaatatacatttctttca |
283 |
Q |
| |
|
|| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4271067 |
gacaaaaaaaacagcaaacaacaaatgttctttttaatttgtttatatttcattcttgagcatatttaatatacatttctttca |
4270984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University