View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_184 (Length: 279)
Name: NF10140A_low_184
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_184 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 36268925 - 36268678
Alignment:
Q |
17 |
tagattgaggtcgactgcttgataatatttgtcggaaggttggggatgagtcttctactctgttttggaatgatccttggttggatggtagatctttgaa |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||| |
|
|
T |
36268925 |
tagattgaggtcgactgcttgataatatttgtcggaaggttggtgatgagtcttctactttgttttgaaatgatccttggttggatcgtagatctttgaa |
36268826 |
T |
 |
Q |
117 |
agatagttttagaagtttgtttgagttagctgataacaaattggcaacagtcgcggagatgttttctttgggttggggagtgaatgacgaggcct-gaag |
215 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | ||| |
|
|
T |
36268825 |
agatagttttagaagtttgtttcagttagctgataacaaattggcaacggtcgcggaaatgttttctttgggttggggagtgaatgacgaggcttaaaag |
36268726 |
T |
 |
Q |
216 |
tagcgtatgaggttgcttgaaagtagcagtcaataatcactgatgtcc |
263 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
36268725 |
tagcgtatgaggttgcttgaaagtagcaatcaataatcagtgatgtcc |
36268678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University