View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_195 (Length: 275)
Name: NF10140A_low_195
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_195 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 9 - 269
Target Start/End: Complemental strand, 50157265 - 50157005
Alignment:
| Q |
9 |
aacagagaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaaccgagacagtgccttggagatcataattgcttgatttc |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50157265 |
aacaaagaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaactgagacagtgccttggagattataattgcttgatttc |
50157166 |
T |
 |
| Q |
109 |
gattaaataattgaactcagttacagtaaaagtgacgagttttcaagttatgtatagaagacttttggataacaatgtaccagtgaatatgctgctcggc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157165 |
gattaaataattgaactcagttacagtaaaagtgacgagtgttcaagttatgtatagaatacttttggataacaatgtaccagtgaatatgctgctcggc |
50157066 |
T |
 |
| Q |
209 |
aaaaaatcttgtccaacatcaacttttagagtgcattcaaaccattccgaaattctaacga |
269 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50157065 |
aaaaaaacttgtccaacctcaacttttagagtgcattcaaaccattccgaaattctaacga |
50157005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University