View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_199 (Length: 271)
Name: NF10140A_low_199
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_199 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 12305929 - 12306168
Alignment:
| Q |
19 |
tcaatggagacagaagcttttcttttttatattcaatcgatgaagaaatgaagattactatagtttaaagcagttcttagtaacttcatacttcttattt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12305929 |
tcaatgaagacagaagcttttcttttttatattcaatcgatgaagaaatgaagattactatagtttaaagcagttcttagtaacttcatacttcttattt |
12306028 |
T |
 |
| Q |
119 |
taattggaatgttaacttggcacttgaattgttatttcttaggatattagcccctaccacatatatattttttgcatcagcaattccagttatttcattt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12306029 |
taattggaatgttaacttggcacttgaattgttatttcttaggatattagcccctaccacatatatattttttgcatcagcaattccagttatttcattt |
12306128 |
T |
 |
| Q |
219 |
ggagaacaattgcaaagagatacaggtacattgttaattt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12306129 |
ggagaacaattgcaaagagatacaggtacattgttaattt |
12306168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Complemental strand, 34927292 - 34927246
Alignment:
| Q |
177 |
acatatatattttttgcatcagcaattccagttatttcatttggaga |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
34927292 |
acatacatattttttgcttcagcaattcctgttatttcttttggaga |
34927246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University