View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_210 (Length: 267)
Name: NF10140A_low_210
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_210 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 30590224 - 30590486
Alignment:
| Q |
1 |
tcattgctattgcagtctacagcagcactttcactgggannnnnnngggaactgatcaagcaatctgacattcagctagcaaaaagagtcggttgttacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590224 |
tcattgctattgcagtctacagcagcactttcactggg-tttttttgggaactgatcaagcaatctgacattcagctagcaaaaagagtcggttgttacc |
30590322 |
T |
|
| Q |
101 |
tgacgaagacctttggaattaaaaggggactgccgaacaatgcgatgtgttcctttctccccagacaaatacccatacgcataacggccttcaacttcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590323 |
tgacgaagacctttggaattaaaaggggactgccgaacaatgcgatgtgttcctttctccccagacaaatacccatacgcataacggccttcaacttcga |
30590422 |
T |
|
| Q |
201 |
tggtggcagatttaattccagcttcttctccaagagatttctcaaccactctggttttgtatct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590423 |
tggtggcagatttaattccagcttcttctccaagagatttctcaaccactctggttttgtatct |
30590486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University